FASTA format

Z Wikipedii, wolnej encyklopedii
Skocz do: nawigacja, szukaj

Format FASTA jest formatem zapisu sekwencji kwasów nukleinowych oraz białek używanym w bioinformatyce. Nukleotydy (dla DNA i RNA) oraz aminokwasy (dla białek) oznaczone są jednoliterowymi skrótami. Format FASTA uwzględnia również możliwość dodawania opisów i komentarzy do sekwencji.

Format[edytuj | edytuj kod]

Dane zapisane w formacie FASTA składają się z pojedynczej linii tekstu zawierającej opis sekwencji oraz z kolejnych linii zawierających samą sekwencję. Linia z opisem rozpoczyna się od znaku "większe niż" (">"). Pierwsze słowo po tym znaku służy jako identyfikator sekwencji. Dalej w tej samej linii umieszczany jest opis. W kolejnych liniach znajduje się ciąg znaków składający się na sekwencję. Przykładowa sekwencje w formacie FASTA wygląda tak:

>Keratyna 5, egzon 2, Homo sapiens
GTGCGGTTCCTGGAGCAGCAGAACAAGGTTCTGGACACCAAGTGGACCCTGCTGCAGGAG
CAGGGCACCAAGACTGTGAGGCAGAACCTGGAGCCGTTGTTCGAGCAGTACATCAACAAC
CTCAGGAGGCAGCTGGACAGCATCGTGGGGGAACGGGGCCGCCTGGACTCAGAGCTGAGA
AACATGCAGGACCTGGTGGAAGACTTCAAGAACAA

Oznaczenia literowe[edytuj | edytuj kod]

Nukleotydy są oznaczane za pomocą:

Symbol Znaczenie
A Adenozyna
C Cytozyna
G Guanina
T Tymina
U Uracyl
R G A (puRyna)
Y T C (pirYmidyna)
K G T (grupa Ketonowa)
M A C (grupa aMinowa)
S G C (Silne oddziaływanie)
W A T (słabe (ang. Weak) oddziaływanie)
B G T C (nie A) (B jest po A)
D G A T (nie C) (D jest po C)
H A C T (nie G) (H jest po G)
V G C A (nie T) (V jest po U)
N A G C T (którykolwiek, od ang. aNy)
X zamaskowany
- przerwa nieokreślonej długości

Aminokwasy są określane za pomocą:

Symbol Znaczenie
A Alanina
B Kwas asparaginowy lub Asparagina
C Cysteina
D Kwas asparaginowy
E Kwas glutaminowy
F Fenyloalanina
G Glicyna
H Histydyna
I Izoleucyna
K Lizyna
L Leucyna
M Metionina
N Asparagina
O Pirolizyna
P Prolina
Q Glutamina
R Arginina
S Seryna
T Treonina
U Selenocysteina
V Walina
W Tryptofan
Y Tyrozyna
Z Kwas glutaminowy lub Glutamina
X którykolwiek
* koniec translacji
- przerwa nieokreślonej długości