Sekwencjonowanie DNA

Z Wikipedii, wolnej encyklopedii
Przejdź do nawigacji Przejdź do wyszukiwania

Sekwencjonowanie DNA – technika odczytywania sekwencji, czyli kolejności par nukleotydowych w cząsteczce DNA.

Sekwencjonowanie dokonuje się obecnie głównie za pomocą zautomatyzowanych sekwenatorów. Manualne sekwencjonowanie stosuje się przy opracowywaniu nowatorskich metod, w niektórych laboratoriach dla krótkich fragmentów lub podczas ćwiczeń[potrzebny przypis].

GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGG
gdzie: A – deoksyadenozyna; C – deoksycytydyna; G – deoksyguanozyna; T – tymidyna

Metody historyczne[edytuj | edytuj kod]

Sekwencjonowania DNA metodą Sangera z użyciem znakowanych dideoksynukleotydów
A – przykładowa sekwencja DNA
B – przyłączenie startowego oligonukleotydu do nici matrycowej i kierunek syntezy DNA
C – produkty syntezy DNA, zakończone fluorescencyjnie znakowanymi dideoksynukleotydami (kolorowe litery)
D – elektroforegram rozdziału otrzymanej mieszaniny fragmentów w elektroforezie kapilarnej wraz z zidentyfikowaną sekwencją (powyżej)
Przykładowy pirogram uzyskany z pirosekwencjonowania

Historyczną już i wypieraną metodą jest opracowana w 1977 r. metoda Sangera, oparta o syntezę DNA przez polimerazę DNA in vitro[1]. Do reakcji dodaje się niewielką ilość trifosforanów dideoksynukleotydów (ddNTP), które są wbudowywane w DNA, ale ich dołączenie uniemożliwia dalsze wydłużanie nici. W ten sposób otrzymuje się fragmenty DNA o różnej długości zakończone specyficznym nukleotydem. Produkty reakcji rozdziela się elektroforetycznie, co powoduję ich segregację pod względem wielkości.

Autorem alternatywnej metody sekwencjonowania DNA, z wykorzystaniem specyficznej, chemicznej degradacji DNA, byli Walter Gilbert i Allan Maxam (metoda Maxama-Gilberta)[2]. Gilbert wraz z Frederickiem Sangerem otrzymali za to osiągnięcie nagrodę Nobla w dziedzinie chemii. Metoda Maxama-Gilberta obecnie jest rzadko stosowana[3].

Metody współczesne[edytuj | edytuj kod]

Obecnie odczyt sekwencji w metodzie Sangera został zautomatyzowany dzięki wykorzystaniu znakowanych fluorescencyjnie trifosforanów dideoksynukleotydów i pozwala na odczyt 300–1000 par zasad z jednej kapilary lub linii na żelu[potrzebny przypis].

Nowoczesne (2013) aparaty do sekwencjonowania DNA są w stanie pracować z szybkością rzędu milionów par zasad dziennie[4]. Tranzystory polowe DNA umożliwiają użycie natywnego DNA w hybrydyzacji do mikromacierzy i odczyt w czasie rzeczywistym.

Nagroda Archon Genomics X PRIZE w wysokości 10 mln dolarów czeka na ośrodek, który będzie w stanie zsekwencjonować 100 genomów ludzkich w ciągu 10 dni[5]. Pierwsze sekwencjonowanie genomu człowieka zajęło wiele lat (zob. Projekt poznania ludzkiego genomu).

Nowoczesne metody sekwencjonowania DNA są na tyle tanie, iż setki tysięcy osób zapłaciły za zbadanie swojego DNA i wzięły udział w Projekcie Genograficznym. Ta względna taniość umożliwiła również rozwój m.in. genetyki genealogicznej oraz wielu rodzajów badań testujących obecność mutacji.

Metody rozwojowe[edytuj | edytuj kod]

  • pirosekwencjonowanie; jego wersja "sekwencjonowanie 454" pozwala odczytać 300 MBp na dzień w jednej maszynie. Metoda ta jest szczególnie przydatna do sekwencjonowania aDNA.
  • bezpośredniego odczytu[potrzebny przypis]:
    • nanosekwencjonowanie. Przesuwająca się cząsteczka DNA poprzez centrum aktywne modyfikowanych polimeraz jest odczytywana bezpośrednio. W roku 2006 szybkość takiego odczytu wynosiła 1 MBp/s dla pojedynczego nanometrowego czujnika[6].
    • mikroskopowe

Historia rozwoju metod sekwencjonowania DNA[edytuj | edytuj kod]

  • 1953 – opracowanie modelu podwójnej helisy DNA przez Jamesa Watsona i Francisa Cricka
  • 1972 – opracowanie sposobów izolacji materiału do dalszych badań. Rozwój technologii rekombinacji umożliwiający izolację dowolnych fragmentów DNA i ich replikację.
  • 1977 – Allan Maxam i Walter Gilbert ogłaszają publikację pt. Sekwencjonowanie DNA przez chemiczną degradację. W tym samym czasie Sanger opublikował też metodę sekwencjonowania DNA przez syntezę katalizowaną enzymatycznie.
  • 1980 – Fred Sanger i Walter Gilbert otrzymali nagrodę Nobla
  • 1982 – utworzono Genbank – publicznie dostępną bazę danych sekwencji DNA
  • 1982 – Akiyoshi Wada zbudował roboty sekwencyjne dla firmy Hitachi.
  • 1984 – badacze z MRC odczytali kompletną sekwencję wirusa Epstein-Barr, 170 kb.
  • 1997 – zsekwencjonowano 5Mb genom bakterii Escherichia coli.
  • 2001, 15 lutego – Konsorcjum HUGO opublikowało sekwencję genomu ludzkiego w Nature.
  • 2001, 16 lutego – firma Celera Genomics opublikowała sekwencję genomu ludzkiego w Science.

Zobacz też[edytuj | edytuj kod]

Przypisy[edytuj | edytuj kod]

  1. Publikacja w otwartym dostępie – możesz ją bezpłatnie przeczytać F. Sanger, S. Nicklen, A. R. Coulson, DNA sequencing with chain-terminating inhibitors, „Proceedings of the National Academy of Sciences of the United States of America”, 74 (12), 1977, s. 5463–5467, PMID271968, PMCIDPMC431765.
  2. Publikacja w otwartym dostępie – możesz ją bezpłatnie przeczytać A. M. Maxam, W. Gilbert, A new method for sequencing DNA, „Proceedings of the National Academy of Sciences of the United States of America”, 74 (2), 1977, s. 560–564, PMID265521, PMCIDPMC392330.
  3. The Nobel Prize in Chemistry 1958 (ang.). nobelprize.org. [dostęp 2013-11-20].
  4. Soh J., Gordon P., Sensen C.: Genome Annotation. Chapman & Hall/CRC, 2013, s. 1. ISBN 978-1-4398-41174.
  5. X PRIZE Foundation Announces Largest Medical Prize in History. $10 Million Archon X PRIZE for Genomics Challenges Private Companies to Map 100 Human Genomes in 10 Days, genomics.xprize.org, 4 października 2006 [zarchiwizowane z adresu 2007-09-08] (ang.).
  6. Technology Overview, visigenbio.com [zarchiwizowane z adresu 2006-07-12] (ang.).