Sekwencjonowanie DNA

Z Wikipedii, wolnej encyklopedii
Skocz do: nawigacji, wyszukiwania

Sekwencjonowanie DNA – technika odczytywania sekwencji, czyli kolejności par nukleotydowych w cząsteczce DNA.

Sekwencjonowanie dokonuje się obecnie głównie za pomocą zautomatyzowanych sekwencjonatorów. Manualne sekwencjonowanie stosuje się przy opracowywaniu nowatorskich metod, w niektórych laboratoriach dla krótkich fragmentów lub podczas ćwiczeń[potrzebne źródło].

GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGG
gdzie: A – deoksyadenozyna; C – deoksycytydyna; G – deoksyguanozyna; T – tymidyna

Metody historyczne[edytuj | edytuj kod]

Sekwencjonowania DNA metodą Sangera z użyciem znakowanych dideoksynukleotydów
A – przykładowa sekwencja DNA
B – przyłączenie startowego oligonukleotydu do nici matrycowej i kierunek syntezy DNA
C – produkty syntezy DNA, zakończone fluorescencyjnie znakowanymi dideoksynukleotydami (kolorowe litery)
D – elektroforegram rozdziału otrzymanej mieszaniny fragmentów w elektroforezie kapilarnej wraz z zidentyfikowaną sekwencją (powyżej)
Przykładowy pirogram uzyskany z pirosekwencjonowania

Historyczną już i wypieraną metodą jest opracowana w 1977 r. metoda Sangera, oparta o syntezę DNA przez polimerazę DNA in vitro[1]. Do reakcji dodaje się niewielką ilość trifosforanów dideoksynukleotydów (ddNTP), które są wbudowywane w DNA, ale ich dołączenie uniemożliwia dalsze wydłużanie nici. W ten sposób otrzymuje się fragmenty DNA o różnej długości zakończone specyficznym nukleotydem. Produkty reakcji rozdziela się elektroforetycznie, co powoduję ich segregację pod względem wielkości.

Autorem alternatywnej metody sekwencjonowania DNA, z wykorzystaniem specyficznej, chemicznej degradacji DNA, byli Walter Gilbert i Allan Maxam (metoda Maxama-Gilberta)[2]. Gilbert wraz z Frederickiem Sangerem otrzymali za to osiągnięcie nagrodę Nobla w dziedzinie chemii. Metoda Maxama-Gilberta obecnie jest rzadko stosowana.

Metody współczesne[edytuj | edytuj kod]

Obecnie odczyt sekwencji w metodzie Sangera został zautomatyzowany dzięki wykorzystaniu znakowanych fluorescencyjnie trifosforanów dideoksynukleotydów i pozwala na odczyt 300-1000 par zasad z jednej kapilary lub linii na żelu[potrzebne źródło].

Nowoczesne masowo równoległe aparaty do sekwencjonowania DNA są w stanie pracować z szybkością rzędu milionów par zasad na godzinę[potrzebne źródło]. Tranzystory polowe DNA umożliwiają użycie natywnego DNA w hybrydyzacji do mikromacierzy i odczyt w czasie rzeczywistym.

Nagroda Archon Genomics X PRIZE w wysokości 10 mln dolarów czeka na ośrodek, który będzie w stanie zsekwencjonować 100 genomów ludzkich w ciągu 10 dni[3]. Pierwsze sekwencjonowanie genomu człowieka zajęło wiele lat (zob. Projekt poznania ludzkiego genomu).

Nowoczesne metody sekwencjonowania DNA są na tyle tanie, iż setki tysięcy osób zapłaciły za zbadanie swojego DNA i wzięły udział w Projekcie Genograficznym. Ta względna taniość umożliwiła również rozwój m.in. genetyki genealogicznej oraz wielu rodzajów badań testujących obecność mutacji.

Metody rozwojowe[edytuj | edytuj kod]

  • pirosekwencjonowanie; jego wersja "sekwencjonowanie 454" pozwala odczytać 300 MBp na dzień w jednej maszynie. Metoda ta jest szczególnie przydatna do sekwencjonowania aDNA.
  • bezpośredniego odczytu[potrzebne źródło]:
    • nanosekwencjonowanie. Przesuwająca się cząsteczka DNA poprzez centrum aktywne modyfikowanych polimeraz jest odczytywana bezpośrednio. Szybkość takiego odczytu może dochodzić od 300 Bp/s dla pojedynczego nanometrowego czujnika[4].
    • mikroskopowe

Historia rozwoju metod sekwencjonowania DNA[edytuj | edytuj kod]

Zobacz też[edytuj | edytuj kod]

Przypisy